Back Home
Vegetos

Journal: Vegetos- An International Journal of Plant Research

Article DOI : 10.5958/2229-4473.2017.00177.X
Year : 2017, Volume : 30, Issue : supplement
First page : (94) Last page : (100)
Print ISSN : 0970-4078. Online ISSN : 2229-4473.


RESEARCH ARTICLE
A SOCIETY FOR PLANT RESEARCH PUBLICATION

Development of Species Specific Markers for the identification of Trichoderma asperellum and Trichoderma harzianum

Devi T Prameela1, Prabhakaran N.1,2,, Kamil Deeba 1

1Division of Plant Pathology, Indian Agricultural Research Institute, New Delhi-110 012, India 2Department of Plant Science, School of Life Sciences, Bharathidasan University, Tiruchirappalli-620 024, Tamil Nadu, India

Corresponding author: Division of Plant Pathology, Indian Agricultural Research Institute, New Delhi-110 012, India. E-mail: trichodbt@gmail.com

Many species of genus Trichoderma are bio-control fungi and commonly distributed in all the geographic regions of the world. Conventional methods are not always satisfactory to discriminate between differentTrichoderma species. Furthermore, culture techniques are labour intensive and require considerable taxonomic expertise. In contrast, molecular techniques such as PCR and DNA sequencing are very sensitive, reliable and rapid methods for species detection. Therefore, the conserved sequences from multiple alignments of target genes ie. Translation Elongation Factor (tef1) and ribosomal subunit (rpb2) were used to design the primers for detection of Trichoderma asperellum and Trichoderma harzianum, respectively. tef1 gene sequences from 13 isolates of Trichoderma asperellum and 14 sequences from 7 different species of Trichoderma were aligned and 688 base pairs conserved region of Trichoderma asperellum was taken for designing the species specific primer. The specific oligonucleotide primer (T2AF 5′- CTCTGCCGTTGACTGTGAACG - 3′ and T2AR 5′-CGATAGTGGGGTTGCCGTCAA - 3′) has been designed with 507 base pairs for the amplification of specific region of Trichoderma asperellum and validated against 50 isolates of seven different species of Trichoderma. The sequences of rpb2 gene from 11 isolates of Trichoderma harzianum and 12 sequences from 12 different species of Trichoderma were aligned and 857 base pairs conserved region of Trichoderma harzianum was taken for designing species specific primer. The speci f ic oligonucl e o t ide primer (Th1F 5′ - TTGCATGGGTTCGCTAAAGG - 3′ and Th1R 5′- TCTTGTCAGCATCATGGCCGT - 3′) has been designed with 824 base pairs for the amplification of specific region of Trichoderma harzianum and validated against 52 isolates of seven different species of Trichoderma. The above said newly designed molecular markers are able to identify Trichoderma asperellum and Trichoderma harzianum accurately with less time. t




Share: